View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13623_low_7 (Length: 275)
Name: NF13623_low_7
Description: NF13623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13623_low_7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 5 - 275
Target Start/End: Original strand, 40406993 - 40407263
Alignment:
| Q |
5 |
catttaagaatattataacttcttttagctttagtatcttccaacatattaaagctaacctacccatatccaccttccccagttataatttgcaaatact |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40406993 |
catttaagaatattataacttcttttagctttagtatcttacaacatattaaagctaacctacccatatccaccttccccagttataatttgcaaatact |
40407092 |
T |
 |
| Q |
105 |
tgagct-aagagacacatatatcaaactttataaatttaaacatgattcacttaaaagttctttagatttatcaaatatttttcagctccaagttctttt |
203 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40407093 |
tgagcttaagagacacatatatcaaactttataaatttaaacatgattcacttaaa-gttctttagatttatcaaatatttttcagctccaagttctttt |
40407191 |
T |
 |
| Q |
204 |
gtggatatttcttctaagcccataataggtaagacaccagcttgtgtaccgtcgctatcactttccatttct |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40407192 |
gtggatatttcttctaagcccataataggtaagacaccagcttgtgtaccgtcgctatcgctttccatttct |
40407263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University