View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13624_high_10 (Length: 237)
Name: NF13624_high_10
Description: NF13624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13624_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 151 - 218
Target Start/End: Complemental strand, 13866695 - 13866628
Alignment:
| Q |
151 |
gagatggtacaaatgaataacaaattatttcaaaatcaattgaggcttttgttagtgaatatctaaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13866695 |
gagatggtacaaatgaataacaaattattttaaaatcaattgaggcttttgttagtgaatatctaaac |
13866628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 24 - 78
Target Start/End: Complemental strand, 13856795 - 13856741
Alignment:
| Q |
24 |
gaatgaatggagttttaaggagggttatatgttctgtaacatggtttatttcata |
78 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
13856795 |
gaatgaatggaattttaaggagtgttatatgtttggtaacatggtttatttcata |
13856741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 27 - 74
Target Start/End: Original strand, 14389751 - 14389798
Alignment:
| Q |
27 |
tgaatggagttttaaggagggttatatgttctgtaacatggtttattt |
74 |
Q |
| |
|
|||||| |||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
14389751 |
tgaatgaagttttaaggagtgttatatgttttgtaacatggtttattt |
14389798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 75
Target Start/End: Complemental strand, 13881468 - 13881424
Alignment:
| Q |
31 |
tggagttttaaggagggttatatgttctgtaacatggtttatttc |
75 |
Q |
| |
|
|||||||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
13881468 |
tggagttttaagtagtgttatatgttttgtaacatggtttatttc |
13881424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 77
Target Start/End: Complemental strand, 16022374 - 16022344
Alignment:
| Q |
47 |
gttatatgttctgtaacatggtttatttcat |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16022374 |
gttatatgttctgtaacatggtttatttcat |
16022344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University