View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13625_low_4 (Length: 333)
Name: NF13625_low_4
Description: NF13625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13625_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 13 - 182
Target Start/End: Original strand, 40828356 - 40828529
Alignment:
| Q |
13 |
aatataataacgaggacaaattctaaccagaatggtat----gtgcctacgaaccatcaaccatacctatattttttatttaaggctgcagttgatgaag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40828356 |
aatataataacgaggacaaattctaaccagaatggtatatatgtgcctatgaaccatcaaccatacctatattttttatttaaggctgcagttgatgaag |
40828455 |
T |
|
| Q |
109 |
taattgtacaattttactcaaataccaaaaaagaagcaaattgcaaattataggttcaattaagtaggggtggg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40828456 |
taattgtacaattttactcaaataccaaaaaagaagcaaattgcaaattataggttcaattaagtaggggtggg |
40828529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 247 - 315
Target Start/End: Original strand, 40828594 - 40828662
Alignment:
| Q |
247 |
ttactaacaattatggaactgaactaaatagttcggttcgattcgaaacagttgggttcggttcgaaac |
315 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40828594 |
ttactaacaattatggaactgaagtaaatagttcggttcgattcgaaacagttgggttcggttcgaaac |
40828662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 314
Target Start/End: Complemental strand, 36928273 - 36928204
Alignment:
| Q |
246 |
attactaacaattatggaactgaact-aaatagttcggttcgattcgaaacagttgggttcggttcgaaa |
314 |
Q |
| |
|
||||||||||||| | |||||||||| ||||| |||||||| ||| |||||||| ||||||||| |||| |
|
|
| T |
36928273 |
attactaacaattctagaactgaactaaaataattcggttcagttcaaaacagttcggttcggtttgaaa |
36928204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University