View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13627_high_6 (Length: 233)
Name: NF13627_high_6
Description: NF13627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13627_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 6475628 - 6475404
Alignment:
| Q |
1 |
caaggcccactaagctcgttacaaactagggtttcaatgtcatatataaaaaaccaaacactgccaccatttcccttttgacaaaaggttccagcagcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6475628 |
caaggcccactaagctcgttacaaactagggtttcaatgtcatatataaaaaaccaaacactaccaccatttctcttttgacaaaaggttccagcagcag |
6475529 |
T |
|
| Q |
101 |
catcagtatccaaaaccctaatttcttcaaatctcggaaccccattttcaaccatggtatgttcatacatacatcaattctctcctagattcaacccaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
6475528 |
catcagtatccaaaaccctaatttcttcaaatctcggaaccccattttcaaccatggtatgttcatacgtacatcaattctctcttagattcaacccaac |
6475429 |
T |
|
| Q |
201 |
actggttcgatttaattgatgatgt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6475428 |
actggttcgatttaattgatgatgt |
6475404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University