View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13627_low_6 (Length: 243)

Name: NF13627_low_6
Description: NF13627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13627_low_6
NF13627_low_6
[»] chr1 (2 HSPs)
chr1 (89-207)||(36601968-36602086)
chr1 (22-88)||(36602121-36602187)


Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 89 - 207
Target Start/End: Complemental strand, 36602086 - 36601968
Alignment:
89 aacatgctttcaactttaaatgtacttatagcttattccctcatgatgtatttcaggttcagataaaaccaaattggattggagtaaaaggtataaagtt 188  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36602086 aacatactttcaactttaaatgtacttatagcttattccctcatgatgtatttcaggttcagataaaaccaaattggattggagtaaaaggtataaagtt 36601987  T
189 gctcttggaattgatgatg 207  Q
    ||||| ||||||| |||||    
36601986 gctctcggaattgctgatg 36601968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 36602187 - 36602121
Alignment:
22 attttgtttttatatcaaatggaatgaaactcaatactcgagggtttacaaccctcgcacacatatt 88  Q
    |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
36602187 attttgttttcatatcaaatggaatcaaactcaatactcgagggtttacaaccctcgcacacatatt 36602121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University