View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13627_low_6 (Length: 243)
Name: NF13627_low_6
Description: NF13627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13627_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 89 - 207
Target Start/End: Complemental strand, 36602086 - 36601968
Alignment:
| Q |
89 |
aacatgctttcaactttaaatgtacttatagcttattccctcatgatgtatttcaggttcagataaaaccaaattggattggagtaaaaggtataaagtt |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602086 |
aacatactttcaactttaaatgtacttatagcttattccctcatgatgtatttcaggttcagataaaaccaaattggattggagtaaaaggtataaagtt |
36601987 |
T |
|
| Q |
189 |
gctcttggaattgatgatg |
207 |
Q |
| |
|
||||| ||||||| ||||| |
|
|
| T |
36601986 |
gctctcggaattgctgatg |
36601968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 36602187 - 36602121
Alignment:
| Q |
22 |
attttgtttttatatcaaatggaatgaaactcaatactcgagggtttacaaccctcgcacacatatt |
88 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602187 |
attttgttttcatatcaaatggaatcaaactcaatactcgagggtttacaaccctcgcacacatatt |
36602121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University