View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13628_low_16 (Length: 269)
Name: NF13628_low_16
Description: NF13628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13628_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 7 - 259
Target Start/End: Complemental strand, 36574470 - 36574218
Alignment:
| Q |
7 |
cattttaccgcccttactctggataccatgtaaagacttatacaatcttcgtttatttttgaaacgaaacgaatgacatgtgtgcattatgaaattaata |
106 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574470 |
cattttactgctcttactctggataccatgtaaagacttatacaatcttcgtttatttttgaaacgaaacgaatgacatgtgtgcattatgaaattaata |
36574371 |
T |
|
| Q |
107 |
ttaatatatcaacatgctgatgttattattgtttaataaataaataggatgaattactttggggtgcatcatggatttatagagcttctggaattagctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574370 |
ttaatatatcaacatgctgatgttattattgtttaataaataaataggatgaattactttggggtgcatcatggatttatagagcttctggaattagctc |
36574271 |
T |
|
| Q |
207 |
ctacaagcaattcatacaatctaacggccacacattaggcgctgatgatgatg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
36574270 |
ctacaagcaattcatacaatctaacggtcacacattaggcgctgacgatgatg |
36574218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University