View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13628_low_22 (Length: 221)
Name: NF13628_low_22
Description: NF13628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13628_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 53 - 200
Target Start/End: Complemental strand, 47320175 - 47320022
Alignment:
| Q |
53 |
agatcaaactaggaattgctacatgcaggattgtagtcaaacttgttattgttcgtcatctttctcttcatctttgagtgc------cgcttcatcaact |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47320175 |
agatcaaactaggaattgctacatgcaggattgtagtcaaacttgttattgttcgtcatctttctcttcatctttgagtgccgctgccgcttcatcaact |
47320076 |
T |
|
| Q |
147 |
tgaagctcatacttcaactctaatccatcatcaccttgttgttcattaccatcc |
200 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47320075 |
tgaagttcatatttcaactctaatccatcatcaccttgttgttcatcaccatcc |
47320022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 27 - 69
Target Start/End: Complemental strand, 47320222 - 47320180
Alignment:
| Q |
27 |
tactgtgaaattgacacataacagatagatcaaactaggaatt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47320222 |
tactgtgaaattgacacataacagatagatcaaactaggaatt |
47320180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 51 - 116
Target Start/End: Complemental strand, 47316662 - 47316597
Alignment:
| Q |
51 |
atagatcaaactaggaattgctacatgcaggattgtagtcaaacttgttattgttcgtcatctttc |
116 |
Q |
| |
|
||||||||||||||||||| ||| | ||| ||||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
47316662 |
atagatcaaactaggaatttctatacgcacgattgtaatcaaacttattattgttcatcatctttc |
47316597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 190
Target Start/End: Complemental strand, 47316599 - 47316568
Alignment:
| Q |
159 |
ttcaactctaatccatcatcaccttgttgttc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47316599 |
ttcaactctaatccatcatcaccttgttgttc |
47316568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University