View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13629_high_13 (Length: 232)
Name: NF13629_high_13
Description: NF13629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13629_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 29719574 - 29719790
Alignment:
| Q |
1 |
ttgaagttgtgatctaagatcctttatatcaaagtctaccccatagattggggatgtatcttgactctcaaaagctttaacaagatcaagttcaaaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29719574 |
ttgaagttgtgatctaagatcctttatatcaaagtctaccccatagattggggatgtatcttgactctcaaaagctttaacaagatcaagttcaaaatga |
29719673 |
T |
|
| Q |
101 |
tgaagatctatggccaattgaaaatatgctttcctggttgaaagtttcatagaagcagctaccatgtgcatcccattgaccttcccaaaagttcatttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29719674 |
tgaagatctatggccaattgaaaatatgctttcctggttgaaagtttcatagaagcagctaccatgtgcatcccattggccttcccaaaagttcatttca |
29719773 |
T |
|
| Q |
201 |
tcgcctttcaagaaatc |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
29719774 |
tcgcctttcaagaaatc |
29719790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University