View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13629_high_9 (Length: 238)

Name: NF13629_high_9
Description: NF13629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13629_high_9
NF13629_high_9
[»] chr1 (2 HSPs)
chr1 (18-238)||(9798374-9798595)
chr1 (67-140)||(49642439-49642512)
[»] scaffold0164 (2 HSPs)
scaffold0164 (55-140)||(18131-18216)
scaffold0164 (67-140)||(28511-28584)
[»] chr8 (1 HSPs)
chr8 (55-140)||(15191758-15191843)
[»] chr7 (1 HSPs)
chr7 (55-128)||(16255197-16255270)
[»] chr6 (1 HSPs)
chr6 (55-128)||(26132117-26132190)
[»] chr3 (3 HSPs)
chr3 (67-140)||(53976788-53976861)
chr3 (55-128)||(31196533-31196606)
chr3 (55-128)||(52771707-52771780)
[»] scaffold0014 (1 HSPs)
scaffold0014 (55-128)||(97177-97250)
[»] chr4 (2 HSPs)
chr4 (55-128)||(13986667-13986740)
chr4 (67-140)||(18252618-18252691)
[»] scaffold0013 (1 HSPs)
scaffold0013 (55-128)||(250294-250367)


Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 9798595 - 9798374
Alignment:
Q  18 cttaaccggtttaaatgattcctttgacatgcttagatctcaaattttgttgatgaaccctttacccactctcaacaagatctttt-ccatggttttgca 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||    
T  9798595 cttaaccggtttaaatgattcctttgacatgcttagatctcaaattttgttgatgaaccctttacccactctcaacaagatttttttccatggttttgca 9798496  T
Q  117 acatgagagacagttcaagatttctacaccagtttatgagtccgaaattctcataaatgctgcttcttatgggagatcacaaggtaggggacgtggcaat 216  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  9798495 acatgagagacagttcaagatttctacaccagtttatgagtccaaaattctcataaatgctgcttcttatgggaaatcacaaggtaggggacgtggcaat 9798396  T
Q  217 ggtccttcattcccctcaaatc 238  Q
    ||||||||||||||||||||||    
T  9798395 ggtccttcattcccctcaaatc 9798374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 67 - 140
Target Start/End: Complemental strand, 49642512 - 49642439
Alignment:
Q  67 ttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagacagttcaagatttc 140  Q
    |||||||| |||||||| ||| |||| ||||| ||||| |||||| ||||||||||||||||||||||||||||    
T  49642512 ttgatgaatcctttaccaactatcaataagattttttctatggttatgcaacatgagagacagttcaagatttc 49642439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0164 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: scaffold0164
Description:

Target: scaffold0164; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 55 - 140
Target Start/End: Complemental strand, 18216 - 18131
Alignment:
Q  55 tctcaaattttgttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagacagttcaagatttc 140  Q
    ||||| ||||| |||||||| |||||||| ||| |||| ||||| ||||| |||||| ||||||||||||||||||||||||||||    
T  18216 tctcagattttattgatgaatcctttaccaactatcaataagattttttctatggttatgcaacatgagagacagttcaagatttc 18131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0164; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 67 - 140
Target Start/End: Complemental strand, 28584 - 28511
Alignment:
Q  67 ttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagacagttcaagatttc 140  Q
    |||||||| |||||||| ||| |||| ||||| ||||| |||||| ||||||||||||||||||||||||||||    
T  28584 ttgatgaatcctttaccaactatcaataagattttttctatggttatgcaacatgagagacagttcaagatttc 28511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 55 - 140
Target Start/End: Original strand, 15191758 - 15191843
Alignment:
Q  55 tctcaaattttgttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagacagttcaagatttc 140  Q
    ||||| ||||| |||||||| |||||||| ||| |||| ||||| ||||| |||||| ||||||||||||||||||||||||||||    
T  15191758 tctcagattttattgatgaatcctttaccaactatcaataagattttttctatggttatgcaacatgagagacagttcaagatttc 15191843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 55 - 128
Target Start/End: Original strand, 16255197 - 16255270
Alignment:
Q  55 tctcaaattttgttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagaca 128  Q
    |||||||| |||||||||||||||||||| |||||||||||||| ||||| ||||| ||||| ||||| |||||    
T  16255197 tctcaaatcttgttgatgaaccctttaccaactctcaacaagattttttcaatggtattgcagcatgaaagaca 16255270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 55 - 128
Target Start/End: Original strand, 26132117 - 26132190
Alignment:
Q  55 tctcaaattttgttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagaca 128  Q
    |||||||| |||||||||||||||||||| |||||||||||||| ||||| ||||| ||||| ||||| |||||    
T  26132117 tctcaaatcttgttgatgaaccctttaccaactctcaacaagattttttcaatggtattgcagcatgaaagaca 26132190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 67 - 140
Target Start/End: Original strand, 53976788 - 53976861
Alignment:
Q  67 ttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagacagttcaagatttc 140  Q
    |||||||| |||||||| ||| |||| ||||| ||||| |||||| ||||||||||||||||||||||||||||    
T  53976788 ttgatgaatcctttaccaactatcaataagattttttctatggttatgcaacatgagagacagttcaagatttc 53976861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 55 - 128
Target Start/End: Complemental strand, 31196606 - 31196533
Alignment:
Q  55 tctcaaattttgttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagaca 128  Q
    |||||||| |||||||||||||||||||| |||||||||||||| ||||| ||||| || || ||||| |||||    
T  31196606 tctcaaatcttgttgatgaaccctttaccaactctcaacaagattttttcaatggtattacagcatgaaagaca 31196533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 55 - 128
Target Start/End: Original strand, 52771707 - 52771780
Alignment:
Q  55 tctcaaattttgttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagaca 128  Q
    |||||||| |||||||||||||||||||| |||||||||||||| ||||| ||||| || || ||||| |||||    
T  52771707 tctcaaatcttgttgatgaaccctttaccaactctcaacaagattttttcaatggtattacagcatgaaagaca 52771780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 55 - 128
Target Start/End: Complemental strand, 97250 - 97177
Alignment:
Q  55 tctcaaattttgttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagaca 128  Q
    |||||||| |||||||||||||||||||| |||||||||||||| ||||| ||||| || || ||||| |||||    
T  97250 tctcaaatcttgttgatgaaccctttaccaactctcaacaagattttttcaatggtattacagcatgaaagaca 97177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 55 - 128
Target Start/End: Original strand, 13986667 - 13986740
Alignment:
Q  55 tctcaaattttgttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagaca 128  Q
    |||||||| |||||||||||||||||||| |||||||||||||| ||||| ||||| || || ||||| |||||    
T  13986667 tctcaaatcttgttgatgaaccctttaccaactctcaacaagattttttcaatggtattacagcatgaaagaca 13986740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 67 - 140
Target Start/End: Original strand, 18252618 - 18252691
Alignment:
Q  67 ttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagacagttcaagatttc 140  Q
    |||||||| |||||||| ||| | || ||||| ||||| |||||| ||||||||||||||||||||||||||||    
T  18252618 ttgatgaatcctttaccaactatgaataagattttttctatggttatgcaacatgagagacagttcaagatttc 18252691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 55 - 128
Target Start/End: Complemental strand, 250367 - 250294
Alignment:
Q  55 tctcaaattttgttgatgaaccctttacccactctcaacaagatcttttccatggttttgcaacatgagagaca 128  Q
    |||||||| |||||||||||||||||||| ||||||||||| || ||||| ||||| || || ||||| |||||    
T  250367 tctcaaatcttgttgatgaaccctttaccaactctcaacaatattttttcaatggtatttcagcatgaaagaca 250294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University