View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362_high_39 (Length: 349)
Name: NF1362_high_39
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362_high_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 88 - 302
Target Start/End: Original strand, 8756293 - 8756507
Alignment:
| Q |
88 |
ctcatgaaacgtgtcttcaccatcataccagctgcagccttccgtaaaacatcctcccatctagaaaactctattggtgatgtttcatggcttcttcgag |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756293 |
ctcatgaaacgtgtcttcaccatcataccagctgcagccttccgtaaaacatcctcccatctagaaaactctattggtgatgtttcatggcttcttcgag |
8756392 |
T |
|
| Q |
188 |
tatctgcccccgctgatgatcgcggtggcgagtatcttggacttccaccaatagcagccaatgaacctatattatgttttatatgggagcagatcgctat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756393 |
tatctgcccccgctgatgatcgcggtggcgagtatcttggacttccaccaatagcagccaatgaacctatattatgttttatatgggagcagatcgctat |
8756492 |
T |
|
| Q |
288 |
gttattcacaggttc |
302 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
8756493 |
gttattcaccggttc |
8756507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University