View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362_high_41 (Length: 345)
Name: NF1362_high_41
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362_high_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 78 - 338
Target Start/End: Complemental strand, 43032549 - 43032281
Alignment:
| Q |
78 |
cctgtgacttaagtgcggtttcattcttagaggagtggaaattgattttagtggtataaaattgattttgacatgtttagatagtctcgattacaaatga |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
43032549 |
cctgtgacttaagtgcggtttcattcttagaggagtggaagttgattttagaggtataaaatcgattttgacttgtttagagagtctcgattacaaatga |
43032450 |
T |
 |
| Q |
178 |
ttttgttgggaagacatagagagcgtcgagagcaacaactagccaaagctcgaccacnnnnnnntgagacgtcacatctctactc--------aaaacat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
43032449 |
ttttgttgggaagacatagagagcgtcgagagcaacaactaaccaaagctcgaccacaaaaaaatgagacgtcacatctctactcaaaaccttaaaacat |
43032350 |
T |
 |
| Q |
270 |
tatgtgtcgtctcttttatgtatcaaatgtcattgtgggattaatcactcaaacttaaaccctatgata |
338 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43032349 |
tatgtgtcatctcttttatgtatcaaatgtcattgtgggattaatcactcaaacttaaactctatgata |
43032281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 107 - 155
Target Start/End: Original strand, 8381899 - 8381947
Alignment:
| Q |
107 |
gaggagtggaaattgattttagtggtataaaattgattttgacatgttt |
155 |
Q |
| |
|
||||||| ||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
8381899 |
gaggagtcaaaattgattctagaggtataaaattgattttgacatgttt |
8381947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 132 - 165
Target Start/End: Original strand, 19067358 - 19067391
Alignment:
| Q |
132 |
tataaaattgattttgacatgtttagatagtctc |
165 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
19067358 |
tataaaattgattttgacatgtttagatattctc |
19067391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University