View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1362_high_41 (Length: 345)

Name: NF1362_high_41
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1362_high_41
NF1362_high_41
[»] chr8 (1 HSPs)
chr8 (78-338)||(43032281-43032549)
[»] chr1 (1 HSPs)
chr1 (107-155)||(8381899-8381947)
[»] chr4 (1 HSPs)
chr4 (132-165)||(19067358-19067391)


Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 78 - 338
Target Start/End: Complemental strand, 43032549 - 43032281
Alignment:
78 cctgtgacttaagtgcggtttcattcttagaggagtggaaattgattttagtggtataaaattgattttgacatgtttagatagtctcgattacaaatga 177  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||| |||||||| ||||||||||||||||||    
43032549 cctgtgacttaagtgcggtttcattcttagaggagtggaagttgattttagaggtataaaatcgattttgacttgtttagagagtctcgattacaaatga 43032450  T
178 ttttgttgggaagacatagagagcgtcgagagcaacaactagccaaagctcgaccacnnnnnnntgagacgtcacatctctactc--------aaaacat 269  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||       |||||||||||||||||||||        |||||||    
43032449 ttttgttgggaagacatagagagcgtcgagagcaacaactaaccaaagctcgaccacaaaaaaatgagacgtcacatctctactcaaaaccttaaaacat 43032350  T
270 tatgtgtcgtctcttttatgtatcaaatgtcattgtgggattaatcactcaaacttaaaccctatgata 338  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
43032349 tatgtgtcatctcttttatgtatcaaatgtcattgtgggattaatcactcaaacttaaactctatgata 43032281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 107 - 155
Target Start/End: Original strand, 8381899 - 8381947
Alignment:
107 gaggagtggaaattgattttagtggtataaaattgattttgacatgttt 155  Q
    |||||||  ||||||||| ||| ||||||||||||||||||||||||||    
8381899 gaggagtcaaaattgattctagaggtataaaattgattttgacatgttt 8381947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 132 - 165
Target Start/End: Original strand, 19067358 - 19067391
Alignment:
132 tataaaattgattttgacatgtttagatagtctc 165  Q
    ||||||||||||||||||||||||||||| ||||    
19067358 tataaaattgattttgacatgtttagatattctc 19067391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University