View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362_high_45 (Length: 318)
Name: NF1362_high_45
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362_high_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 95 - 305
Target Start/End: Complemental strand, 53079233 - 53079023
Alignment:
| Q |
95 |
tatttgtccattttaccctcaaccactacttgttgaagatttgtaacctactctttggaaagtgaatctgttttgtcatnnnnnnnttgatgttgttttc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53079233 |
tatttgtccattttaccctcaaccactacttgttgaagatttgtaacctactctttggaaagtgaatctgttttgtcataaaaaaattgatgttgttttc |
53079134 |
T |
|
| Q |
195 |
acaattaaataaattgtattaattgtttggtatatatcttctttgtggtccgttaatttagcccttgatggatttgattgttcctagtttggtcaatttg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53079133 |
acaattaaataaattgtattaattgtttggtatatatcttctttgtggtccgttaatttagcccttgatggatttgattgttcctagtttggtcaatttg |
53079034 |
T |
|
| Q |
295 |
ttgccgttcat |
305 |
Q |
| |
|
|||| |||||| |
|
|
| T |
53079033 |
ttgctgttcat |
53079023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University