View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362_high_59 (Length: 251)
Name: NF1362_high_59
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362_high_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 15 - 242
Target Start/End: Complemental strand, 26523854 - 26523623
Alignment:
| Q |
15 |
gaggaaggaatgaggagagttcgtgattcaaatctagataggttaaaatatcgaggcaaaatagagtgaacttgtggtaaacgaaaatattattaaatta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26523854 |
gaggaaggaatgaggagagttcgtgattcaaatctagataggttaaaatatcgaggcaaaatagagtgaacttgtggtaaacaaaaatattattaaatta |
26523755 |
T |
 |
| Q |
115 |
gggcttggaaggtgtaaaaatatattgccagttgtannnnnnnnnnnnnaaaattttgggtggaaacaaagtgtaggtgtgttgtgtct----tttgatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26523754 |
gggcttggaaggtgtaaaaatatattgccagttgtattttttattttttaaaattttgggtggaaacaaagtgtaggtgtgttgtgtctttggtttgatt |
26523655 |
T |
 |
| Q |
211 |
tgagattatcatagtgagtaggaggaggagga |
242 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
26523654 |
tgagattatcatagtgagtagtaggaggagga |
26523623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University