View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362_high_67 (Length: 209)
Name: NF1362_high_67
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362_high_67 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 14 - 194
Target Start/End: Original strand, 26523439 - 26523616
Alignment:
| Q |
14 |
ataaataaacactataccctataattgttactattataattactattaccccacctgtagcagcctaactaaaccatgaattaaaatagaattaatgttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26523439 |
ataaataaacactataccctataattgttactattataattactattaccccacctgtagcagcctaactaaaccatgaattaaaatagaattaatgttc |
26523538 |
T |
|
| Q |
114 |
catattattgatccatcatttttcacgtaggtagtagtagggttgtgctgttgtacgtggaagtcttcctcattaaacgac |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
26523539 |
catattattgatccatcatttttcacgtag---gtagtagggttgtgctgttgtacgtggaagtcttcttcaataaacgac |
26523616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University