View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362_low_32 (Length: 416)
Name: NF1362_low_32
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 122 - 331
Target Start/End: Original strand, 47032961 - 47033170
Alignment:
| Q |
122 |
cgttacccgtttctcttctcgctttccgatttcggaaacttacctgataaaccgcataagaatattgtcagattgcttaaagggaaagcttttaggaaac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47032961 |
cgttacccgtttctcttctcgctttccgatttcggaaacttacctgataaaccgcataagaatattgtcagattgcttaaagggaaagcttttaggaaac |
47033060 |
T |
 |
| Q |
222 |
ctgatatttcggttactgttcaggaggtgcttgagaaagcgaagagtaaggggatggatgggttggttgttgatgtgggtgctaatgtgggaatggcgag |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47033061 |
ctgatatttcggttactgttcaggaggtgcttgagaaagcgaagagtaaggggatggatgggttggttgttgatgtgggtgccaatgtgggaatggcgag |
47033160 |
T |
 |
| Q |
322 |
tttcgcggca |
331 |
Q |
| |
|
|||||||||| |
|
|
| T |
47033161 |
tttcgcggca |
47033170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University