View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362_low_40 (Length: 363)
Name: NF1362_low_40
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362_low_40 |
 | |
|
| [»] scaffold0041 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0041 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 1768 - 1901
Alignment:
| Q |
1 |
caattgccaaaactcattagaatgatgtatcagctacctaaatgtacaaaggtacaaaaagaaacaaagaatgaaccaacaattgtaaattgacagtaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1768 |
caattgccaaaactcattagaatgatgtatcagctacctaaatgtacaaaggtacaaaaagaaacaaagaatgaaccaacaattgtaaattgacagttga |
1867 |
T |
|
| Q |
101 |
gataaatttcaaggtaaaaactcaatattgttgc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1868 |
gataaatttcaaggtaaaaactcaatattgttgc |
1901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 286 - 353
Target Start/End: Original strand, 2015 - 2082
Alignment:
| Q |
286 |
gggcttttgtggtttggacgaaaattgaggtaaaaagaggggaattaagtctgttccgattacctttg |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2015 |
gggcttttgtggtttggacgaaaattgaggtaaaaagaggggaattaagtctgttccgattacctttg |
2082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 156 - 189
Target Start/End: Original strand, 1885 - 1918
Alignment:
| Q |
156 |
aaactcaatattgttgcaatgtgactagaacatt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1885 |
aaactcaatattgttgcaatgtgactagaacatt |
1918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University