View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362_low_53 (Length: 307)
Name: NF1362_low_53
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362_low_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 9 - 297
Target Start/End: Complemental strand, 11612945 - 11612657
Alignment:
| Q |
9 |
agcaaaggaaaaagaaaaggaccttaagactaaaaggcaaaccaaacatgcagaagaaactagatcaatggaaataatttacaaaatcaattagagtgag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11612945 |
agcaaaggaaaaagaaaaggaccttaagactaaaaggcaaaccaaacatgcagaagaaactagatcaatggaaatactttacaaaatcaattagagtgag |
11612846 |
T |
 |
| Q |
109 |
gacaaaagcagaagctagattacatcataccaaactatatagaaacatgaaaattaaaaaaggcttcatgttgaagataaagaccagctgaactgtaaca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612845 |
gacaaaagcagaagctagattacatcataccaaactatatagaaacatgaaaattaaaaaaggcttcatgttgaagataaagaccagctgaactgtaaca |
11612746 |
T |
 |
| Q |
209 |
ggtccactctcacagtcataccaaccaaccataacaaaatctttaacattaagcaatttctaagataacccttgtaagcttatcctttg |
297 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11612745 |
ggtccactctcacagtcacaccaaccaaccataacaaaatctttaacattaagcaatttctaatgtaacccttttaagcttatcctttg |
11612657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University