View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1362_low_55 (Length: 288)

Name: NF1362_low_55
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1362_low_55
NF1362_low_55
[»] chr7 (2 HSPs)
chr7 (67-236)||(41764544-41764713)
chr7 (116-222)||(41756651-41756757)
[»] chr1 (1 HSPs)
chr1 (139-221)||(26973807-26973889)
[»] chr3 (3 HSPs)
chr3 (157-222)||(36806094-36806159)
chr3 (169-223)||(49301577-49301631)
chr3 (157-222)||(36515067-36515132)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 67 - 236
Target Start/End: Original strand, 41764544 - 41764713
Alignment:
67 atgatggtccattatgtctatgtacgagactctcgtgcttatgacctcttaaggataaccgtcaaagactacatcaatgtcctttccgaaaaatatccct 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41764544 atgatggtccattatgtctatgtacgagactctcgtgcttatgacctcttaaggataaccgtcaaagactacatcaatgtcctttccgaaaaatatccct 41764643  T
167 attggaaccgaagtcatggagctgatcatttcatacttgcttgccatgattgggtaaatctatcactagc 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41764644 attggaaccgaagtcatggagctgatcatttcatacttgcttgccatgattgggtaaatctatcactagc 41764713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 116 - 222
Target Start/End: Original strand, 41756651 - 41756757
Alignment:
116 taaggataaccgtcaaagactacatcaatgtcctttccgaaaaatatccctattggaaccgaagtcatggagctgatcatttcatacttgcttgccatga 215  Q
    |||||| |||| ||| ||| || ||||||||  |||||||||||||||||| |||||||||||| | |||||||||||||||||| ||| ||||||||||    
41756651 taaggaaaaccatcacagattatatcaatgtggtttccgaaaaatatcccttttggaaccgaagccttggagctgatcatttcatgctttcttgccatga 41756750  T
216 ttgggta 222  Q
    |||||||    
41756751 ttgggta 41756757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 139 - 221
Target Start/End: Complemental strand, 26973889 - 26973807
Alignment:
139 atcaatgtcctttccgaaaaatatccctattggaaccgaagtcatggagctgatcatttcatacttgcttgccatgattgggt 221  Q
    ||||||||| || | | ||||||||| ||||||||  |||| | |||||||||||||||||| || ||||||||||| |||||    
26973889 atcaatgtcattgctggaaaatatccatattggaatagaagccttggagctgatcatttcatgctagcttgccatgactgggt 26973807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 157 - 222
Target Start/End: Original strand, 36806094 - 36806159
Alignment:
157 aaatatccctattggaaccgaagtcatggagctgatcatttcatacttgcttgccatgattgggta 222  Q
    |||||| | ||||||||  ||||| ||||||||||||||||||| ||| |||| ||||||||||||    
36806094 aaatatgcatattggaatagaagttatggagctgatcatttcatgctttcttgtcatgattgggta 36806159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 223
Target Start/End: Original strand, 49301577 - 49301631
Alignment:
169 tggaaccgaagtcatggagctgatcatttcatacttgcttgccatgattgggtaa 223  Q
    |||||| ||| |||||| ||||| || ||||| ||||||||||||||||||||||    
49301577 tggaacagaactcatggtgctgaccacttcatgcttgcttgccatgattgggtaa 49301631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 222
Target Start/End: Complemental strand, 36515132 - 36515067
Alignment:
157 aaatatccctattggaaccgaagtcatggagctgatcatttcatacttgcttgccatgattgggta 222  Q
    |||||| | ||||||||  ||||| |||||||||| |||||||| ||| |||| ||||||||||||    
36515132 aaatatgcttattggaatagaagttatggagctgaccatttcatgctttcttgtcatgattgggta 36515067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University