View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362_low_57 (Length: 277)
Name: NF1362_low_57
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362_low_57 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 135 - 277
Target Start/End: Complemental strand, 428167 - 428025
Alignment:
| Q |
135 |
tacttgctcaggccactcagaagaaatttcggacatcaactcaatgattttactgctgatgacattcaatattttaccaatgacttgtgtcatacgtaag |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
428167 |
tacttgctcaggccactcagaagaaatttcggacatcaactcaatgattttactgctgatgacattcaatattttaccaatgacttgtgtcatacgtaag |
428068 |
T |
|
| Q |
235 |
tatttgatcccaaacttcaaactcgtaaatcatttaaagacga |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
428067 |
tatttgatcccaaacttcaaactcgtaaatcatttaaagacga |
428025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University