View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362_low_66 (Length: 256)
Name: NF1362_low_66
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362_low_66 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 29 - 256
Target Start/End: Original strand, 24827489 - 24827713
Alignment:
| Q |
29 |
aaaaagttggattaagctgatacaataccatgttaacctcaaaattttcatttttaaaccttttatagtaggtccatattagagctagaatcaccctaga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24827489 |
aaaaagttggattaagctgatacaataccatgttaacctcaaaattttcatttttaaaccttttatagtaggtccatattagagctagaatcaccctaga |
24827588 |
T |
 |
| Q |
129 |
aagnnnnnnnnntatgattatgattctattgacacaacttgattggttccaaatctcatgttttaagaaattttatgtaacatcatcatgagcttggtct |
228 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24827589 |
aagaaaaaaaaatatgattatgattctattgacacaacttgattggttccaaatctcatgttttaagaaattttatgtaa---catcatgagcttggtct |
24827685 |
T |
 |
| Q |
229 |
ttgacataacctttttatatatgttttt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
24827686 |
ttgacataacctttttatatatgttttt |
24827713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University