View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362_low_77 (Length: 203)
Name: NF1362_low_77
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362_low_77 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 53682565 - 53682506
Alignment:
| Q |
1 |
aaaagtgcttccataaacactcataaatcatctgtgaaaattatttttatgtcaacagta |
60 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682565 |
aaaagtgcatctataaacactcataaatcatctgtgaaaattatttttatgtcaacagta |
53682506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University