View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13631_high_11 (Length: 246)
Name: NF13631_high_11
Description: NF13631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13631_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 58 - 237
Target Start/End: Complemental strand, 6195426 - 6195249
Alignment:
| Q |
58 |
tttattatactcatggattcccgttaaactacttgtcccgttacatgacggatgatatccccaataccggcgggcacatannnnnnngacatatacctaa |
157 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||| |||| ||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
6195426 |
tttattatactcatggatacccgttaaactacttgccccgttatatgatggatgttatccccaataccggcgggcacatatttttttgacata--cctaa |
6195329 |
T |
 |
| Q |
158 |
tccaattcttttattgttttaaaataaattttatcaaatatgattgagatacttcgtagatacatctttgttagaataat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6195328 |
tccaattcttttattgttttaaaataaattttatcaaatatgattgagatacttcgtagatacatctttgttagagtaat |
6195249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 89
Target Start/End: Complemental strand, 36071280 - 36071218
Alignment:
| Q |
27 |
atccgtaaagaaacaggtatttaaatatccgtttattatactcatggattcccgttaaactac |
89 |
Q |
| |
|
||||||||||||||||||| ||| ||| | ||||||||||| |||||| |||||||||||| |
|
|
| T |
36071280 |
atccgtaaagaaacaggtaattagatactcatttattatacttatggatatccgttaaactac |
36071218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University