View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13631_low_10 (Length: 356)
Name: NF13631_low_10
Description: NF13631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13631_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 64 - 338
Target Start/End: Complemental strand, 2389741 - 2389467
Alignment:
| Q |
64 |
attaaaggacaattgatgaatcgcatccaagagagtagaaattgcagaagcatgtagctagataccccagttcctatacagtaacatgtatatttcatgt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389741 |
attaaaggacaattgatgaatcgcatccaagagagtagaaattccagaagcatgtagctagataccccagttcctatacagtaacatgtatatttcatgt |
2389642 |
T |
 |
| Q |
164 |
atcttgagaattgagattgttggataacaatgttttatgtactaaattattttattcagcttcgagtttcgcctaagggtctgtttggcagcagatggcc |
263 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389641 |
atcttgagaattgagattgttggatgacaatgttttatgtactaaattattttattcagcttcgagtttcgcctaagggtctgtttggcagcagatggcc |
2389542 |
T |
 |
| Q |
264 |
gtctgaatatgatatctcgcatccggaatgtcaatggcaagcctttcagtttctcctttgcatttcatacatatt |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389541 |
gtctgaatatgatatctcgcatccggaatgtcaatggcaagcctttcagtttctcctttgcatttcatacatatt |
2389467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University