View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13631_low_11 (Length: 326)
Name: NF13631_low_11
Description: NF13631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13631_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 7 - 318
Target Start/End: Complemental strand, 54472399 - 54472088
Alignment:
| Q |
7 |
attaattaattaacttcctccattaactattctaaacttcataacatgcttatttgcaaattcctattnnnnnnngaaataggagatatataaaaatata |
106 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54472399 |
attaattaattagcttcccccattaactattctaaacttcataacatgcttatttgcaaattcctattaaaaaaagaaataggagatatataaaaatata |
54472300 |
T |
|
| Q |
107 |
taccgtgtgctggagtagggtagtaatgaatgtgatgaggttgtgatctcttcttccttcttgtacatataacgcagagtaggataatgacaaggaggat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472299 |
taccgtgtgctggagtagggtagtaatgaatgtgatgaggttgtgatctcttcttccttcttgtacatataacgcagagtaggataatgacaaggaggat |
54472200 |
T |
|
| Q |
207 |
tatacaagctgcacctgcaactgctattataccccccacgctcaattgattcccattgttatcatttgtattgttgccgttgttcgagggtgatgattta |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472199 |
tatacaagctgcacctgcaactgctattataccacccacgctcaattgattcccattgttatcatttgtattgttgccgttgttcgagggtgatgattta |
54472100 |
T |
|
| Q |
307 |
tgatgatgatgt |
318 |
Q |
| |
|
|||||||||||| |
|
|
| T |
54472099 |
tgatgatgatgt |
54472088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University