View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13631_low_13 (Length: 246)

Name: NF13631_low_13
Description: NF13631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13631_low_13
NF13631_low_13
[»] chr6 (1 HSPs)
chr6 (58-237)||(6195249-6195426)
[»] chr3 (1 HSPs)
chr3 (27-89)||(36071218-36071280)


Alignment Details
Target: chr6 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 58 - 237
Target Start/End: Complemental strand, 6195426 - 6195249
Alignment:
58 tttattatactcatggattcccgttaaactacttgtcccgttacatgacggatgatatccccaataccggcgggcacatannnnnnngacatatacctaa 157  Q
    |||||||||||||||||| |||||||||||||||| ||||||| |||| ||||| |||||||||||||||||||||||||       ||||||  |||||    
6195426 tttattatactcatggatacccgttaaactacttgccccgttatatgatggatgttatccccaataccggcgggcacatatttttttgacata--cctaa 6195329  T
158 tccaattcttttattgttttaaaataaattttatcaaatatgattgagatacttcgtagatacatctttgttagaataat 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
6195328 tccaattcttttattgttttaaaataaattttatcaaatatgattgagatacttcgtagatacatctttgttagagtaat 6195249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 89
Target Start/End: Complemental strand, 36071280 - 36071218
Alignment:
27 atccgtaaagaaacaggtatttaaatatccgtttattatactcatggattcccgttaaactac 89  Q
    ||||||||||||||||||| ||| |||  | ||||||||||| ||||||  ||||||||||||    
36071280 atccgtaaagaaacaggtaattagatactcatttattatacttatggatatccgttaaactac 36071218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University