View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13631_low_14 (Length: 246)
Name: NF13631_low_14
Description: NF13631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13631_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 13 - 229
Target Start/End: Original strand, 9503749 - 9503965
Alignment:
| Q |
13 |
aatattggtctgttactctagtgatgcagagtatacatagaatgatggaaactgaatcattaactgaaggcttgcattccaaatattggttcagaagttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9503749 |
aatattggtctgttactctagtgatgcagagtatacatagaatgatggaaactgaatcattaactgaaggcttgcattccaaatattggttcagaagttg |
9503848 |
T |
 |
| Q |
113 |
aacaattcaaatatttctgtgttgacctccaagcgctgcatacgcctatggtgttatcttgcatttgatcacaagttttttcactgtacttgatgccaag |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9503849 |
aacaattcaaatatttctgtgatgacctccaagcgctgcatacgcctatggtgttatcttgcatttgatcacaagttttttcactgtacttgatgccaag |
9503948 |
T |
 |
| Q |
213 |
aacttgcttaggacttg |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9503949 |
aacttgcttaggacttg |
9503965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University