View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13631_low_15 (Length: 241)
Name: NF13631_low_15
Description: NF13631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13631_low_15 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 21 - 241
Target Start/End: Original strand, 18637731 - 18637951
Alignment:
| Q |
21 |
catgtttggattgcggtacagaaaactccttttcaagacaagaattactccaaatttctaacttacaaccaccatcaccttccggatttctcacaatcaa |
120 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18637731 |
catgtttcgattgcggtacagaaaactcgttttcaagacaagaattactccaaatttcaaacttacaaccaccatcaccttccggatttctcacaatcaa |
18637830 |
T |
 |
| Q |
121 |
aagcttcgaacccgatggcgacggaaccataacagaaactccagtcatctcaacaggaaacggagcccaatctaaaacaacggaaccgtcgctccgtttg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18637831 |
aagcttcgaacccgatggcgacggaaccataacagaaactccagtcatctcaacaggaaacggagcccaatctaaaccaacggaaccgtcgctccgtttg |
18637930 |
T |
 |
| Q |
221 |
ttaacggttgacgatagaata |
241 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
18637931 |
ttaacggttgacgatagaata |
18637951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University