View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13632_high_21 (Length: 239)
Name: NF13632_high_21
Description: NF13632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13632_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 38522929 - 38523142
Alignment:
| Q |
1 |
ttcgaaagagtttacctcacatttgagtgtcacaagactcgagtgattagtctccacaagttgcgcatagaggatacctgatttacatnnnnnnnnnnnn |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
38522929 |
ttcggaagagtttacctcacatttgagtgtcacaagactcgagtgattagtctccgtaagttacgcatagaggatacctgatttacataaaaaaaaa--- |
38523025 |
T |
|
| Q |
101 |
nnnnngttatcggaatatcaatgatcctaaatttgcatagttgaagacttaatcattagttgaatcattgaactaatttatcatcaaatatgatatgtta |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38523026 |
-----gttatctgaatatcaatgatcctaaatttgcatagttgaagacttagtcattagttgaatcattgaactaatttatcatcaaatatgatatgtta |
38523120 |
T |
|
| Q |
201 |
atctgaaacaaacaaacaatac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38523121 |
atctgaaacaaacaaacaatac |
38523142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 45778962 - 45779026
Alignment:
| Q |
22 |
tttgagtgtcacaagactcgagtgattagtctccacaagttgcgcatagaggatacctgatttaca |
87 |
Q |
| |
|
||||||| |||||| ||||||| ||||||||||| | ||||||| || ||||||||||| |||||| |
|
|
| T |
45778962 |
tttgagtctcacaatactcgagggattagtctccgc-agttgcgaatggaggatacctggtttaca |
45779026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University