View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13632_high_26 (Length: 221)
Name: NF13632_high_26
Description: NF13632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13632_high_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 18905242 - 18905101
Alignment:
| Q |
1 |
gagagaaaaagaggagataaggatgatcttgtttctacttcaacaaaatgatgatgccagaa-ggnnnnnnnntcaattggaatttttgtggtttgttgt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||| |||||||||| |||||||| |
|
|
| T |
18905242 |
gagagaaaaagaggagataaggatgatcttgtttctacttcaacaaaatgatgatg-cagaagggaaaaaaaatcaattgaaatttttgtgctttgttgt |
18905144 |
T |
|
| Q |
100 |
tatgttatgtgatgtcaattggaatttttcacgtgccccttcc |
142 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
18905143 |
tatgttatgcgatgtcaattggaatttttcacgtgctccttcc |
18905101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 11938498 - 11938553
Alignment:
| Q |
1 |
gagagaaaaagaggagataaggatgatcttgtttctacttcaacaaaatgatgatg |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11938498 |
gagagaaaaagaggagataaggatgatcttgtttctacttcaacaaaaggatgatg |
11938553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 43899829 - 43899691
Alignment:
| Q |
1 |
gagagaaaaagaggagataaggatgatcttgtttctacttcaacaaaatgatgatgccagaaggnnnnnnnn-tcaattggaatttttgtggtttgttgt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||| |||||||| |
|
|
| T |
43899829 |
gagagaaaaagaggagataaggatgatcttgtttctacttcaa---aatgatgatgc-agaagggaaaaaaaatcaattggaatttttgtgctttgttgt |
43899734 |
T |
|
| Q |
100 |
tatgttatgtgatgtcaattggaatttttcacgtgccccttcc |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43899733 |
tatgttatgtgatgtcaattggaatttttcatgtgccccttcc |
43899691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University