View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13632_high_27 (Length: 218)
Name: NF13632_high_27
Description: NF13632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13632_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 16 - 137
Target Start/End: Complemental strand, 4523280 - 4523159
Alignment:
| Q |
16 |
cataggcgagtaaagcgacttgggttgtgatttagccaaaaattggatcattatatgatccactcaaacttcattgctccgatttcagcttagatggcca |
115 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4523280 |
catagacgagtaaagcgacctgggttgtgatttagccaaaaattggatcattatatgatacactcaaacttcattgctcagatttcagcttagatggcca |
4523181 |
T |
|
| Q |
116 |
aaaacaaattaaggattaacta |
137 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
4523180 |
aaaacaaatcaaggattaacta |
4523159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 148 - 202
Target Start/End: Complemental strand, 4522677 - 4522623
Alignment:
| Q |
148 |
tgtccaccagcaacatcatctctaacgactcccttggatcacgccgcatatcatg |
202 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4522677 |
tgtccactagcaacatcatctctaaccactcccttggatcacgccgcatatcatg |
4522623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University