View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13632_low_15 (Length: 300)
Name: NF13632_low_15
Description: NF13632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13632_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 3e-48; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 176 - 281
Target Start/End: Complemental strand, 14223991 - 14223886
Alignment:
| Q |
176 |
atcaccattgaattatatggagagattgaccataagaccaacattttattttggaaaaagtaattttggcttactatgtacaaaccatcagctgcatgta |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
14223991 |
atcaccattgaattatatggagagattgaccataagaccaacattttattttggaaaaagtaattttggtttactatgtaccaaccatcagctgcatgta |
14223892 |
T |
|
| Q |
276 |
gtcgtg |
281 |
Q |
| |
|
|||||| |
|
|
| T |
14223891 |
gtcgtg |
14223886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 14 - 82
Target Start/End: Complemental strand, 14231672 - 14231604
Alignment:
| Q |
14 |
atcatcaaagagtggattacttaatgccatggtagcaagagaaatcaccagcagccatgtgagaagaga |
82 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||| ||||| ||| ||||||| |||| |
|
|
| T |
14231672 |
atcatcaaagagtggattactcaatgccatgctagcaagagaaatccccagcggccctgtgagaggaga |
14231604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 148 - 199
Target Start/End: Complemental strand, 14231323 - 14231272
Alignment:
| Q |
148 |
cattgaaaatacagcccaacaaaaggtaatcaccattgaattatatggagag |
199 |
Q |
| |
|
||||||||||| | ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14231323 |
cattgaaaataaaaccctacaaaaggtaatcaccattgaattatatggagag |
14231272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University