View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13632_low_18 (Length: 254)
Name: NF13632_low_18
Description: NF13632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13632_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 30882066 - 30881830
Alignment:
| Q |
1 |
aaaacggaaattaggttaagttgttaaagagaaagaaaagtgaaattgagagaggaaagagtgtgttgagaaagcgtacaatgggttgggtcataaccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30882066 |
aaaacggaaattaggttaagttgttaaagagaaagaaaagtgaaattgagagaggaaagagtgtgttgagaaagcgtacaatgggttgggtcataaccct |
30881967 |
T |
 |
| Q |
101 |
ctgaactttggtgctcgccatggcagctggtgagggtgagcggacggtgaaggtttggagagacgatgagagctaaaccctaaaaattgagcgacggtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30881966 |
ctgaactttggtgctcgccatggcagctggtgagggtgagcggacggtgaaggtttggagagacgatgagagctaaaccctaaaaattgagcgacggtga |
30881867 |
T |
 |
| Q |
201 |
ctaatgctgctagctcactcactgagagggttttagt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30881866 |
ctaatgctgctagctcactcactgagagggttttagt |
30881830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 37 - 194
Target Start/End: Complemental strand, 44988375 - 44988219
Alignment:
| Q |
37 |
aaagtgaaattgagagaggaaagagtgtgttgagaaagcgtacaatgggttgggtcataaccctctgaactttggtgctcgccatggcagctggtgaggg |
136 |
Q |
| |
|
|||| |||||||| || |||||||||||| ||||||||| |||||||||||||||||| ||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
44988375 |
aaagagaaattgaaag-ggaaagagtgtgatgagaaagcatacaatgggttgggtcatgaccctttgaactttggtactcgccatggcagcaggtgaggg |
44988277 |
T |
 |
| Q |
137 |
tgagcggacggtgaaggtttggagagacgatgagagctaaaccctaaaaattgagcga |
194 |
Q |
| |
|
|| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44988276 |
tgtgcggacgatgaaggtttggagagacgatgagagctaaaccctagaaattgagcga |
44988219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 44988400 - 44988367
Alignment:
| Q |
1 |
aaaacggaaattaggttaagttgttaaagagaaa |
34 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
44988400 |
aaaacggagattaggttaagttgttaaagagaaa |
44988367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University