View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13632_low_22 (Length: 237)
Name: NF13632_low_22
Description: NF13632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13632_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 83 - 221
Target Start/End: Original strand, 42519628 - 42519766
Alignment:
| Q |
83 |
gtttagatatatgctgtcaggtatttttattatataaacagctaagtttttatttatcgacaaaataaacaacttgagttaatatagatgctcatccata |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42519628 |
gtttagatatatgctgtcaggtatttttattatataaacagctaagtttttatttatcgacaaaataaacaacttgagttaatatagatgctcatccata |
42519727 |
T |
 |
| Q |
183 |
tttcgatcaaaagtttaaaataataacatatattcttag |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42519728 |
tttctatcaaaagtttaaaataataacatatattcttag |
42519766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 161 - 208
Target Start/End: Original strand, 1241520 - 1241567
Alignment:
| Q |
161 |
ttaatatagatgctcatccatatttcgatcaaaagtttaaaataataa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1241520 |
ttaatatagatgctcatccatatttcgatcaaaagtttaaaataataa |
1241567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University