View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13632_low_28 (Length: 209)
Name: NF13632_low_28
Description: NF13632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13632_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 192
Target Start/End: Complemental strand, 23398426 - 23398387
Alignment:
| Q |
153 |
ctatagtaagcaaccaccaaataacttgtataatattgtt |
192 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23398426 |
ctatagtaagcaaccaccaaataacatgtataatattgtt |
23398387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 47
Target Start/End: Complemental strand, 23398566 - 23398538
Alignment:
| Q |
19 |
aaaatatcacattgttctgggtagctttt |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23398566 |
aaaatatcacattgttctgggtagctttt |
23398538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University