View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13633_high_10 (Length: 238)
Name: NF13633_high_10
Description: NF13633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13633_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 111 - 223
Target Start/End: Complemental strand, 30708026 - 30707914
Alignment:
| Q |
111 |
tttttgtatttacttaatcaaaaggtccttatcataattaattaaattttatcctttcatttaatacagggaacacaaaaaattagtgagtggatttcta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30708026 |
tttttgtatttacttaatcaaaaggtccttatcataattaattaaattttatcctttcatttaatacagggaacacaaaaaattagtgagtggatttcta |
30707927 |
T |
 |
| Q |
211 |
ggtagtgcaaagt |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30707926 |
ggtagtgcaaagt |
30707914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 30708065 - 30708026
Alignment:
| Q |
1 |
aattgttgttttcaaataaaacttgatatttttagttact |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30708065 |
aattgttgttttcaaataaaacttgatatttttagttact |
30708026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University