View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13633_high_13 (Length: 201)
Name: NF13633_high_13
Description: NF13633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13633_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 183
Target Start/End: Original strand, 41263849 - 41264012
Alignment:
| Q |
20 |
atcaatgaacagtattagcatcacaattacagatgaaagtgtcgaaaatatgcatatggaagatcactttgagtgaagatattttgattaccgtgtaata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263849 |
atcaatgaacagtattagcatcacaattatagatgaaagtgtcgaaaatatgcatatggaagatcactttgagtgaagatattttgattaccgtgtaata |
41263948 |
T |
 |
| Q |
120 |
acccctttcgatcgaggcaacagaatttcagtagataaacaggagaagatgtggtgggtttctg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263949 |
acccctttcgatcgaggcaacagaatttcagtagataaacaggagaagatgtggtgggtttctg |
41264012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University