View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13633_high_8 (Length: 261)
Name: NF13633_high_8
Description: NF13633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13633_high_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 114 - 237
Target Start/End: Original strand, 1026099 - 1026222
Alignment:
| Q |
114 |
taagatttacatacatcttatatctatgatcattttgttgcatatttccttttgaagttgtatgcaaattaaaggtgctaaagtgagtctaagattcact |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1026099 |
taagatttacatacatcttatatctatgatcattttgttgcatatttccttttgaagttgtatgcaaattaaaggtgctaaagtgagtctaagattcact |
1026198 |
T |
|
| Q |
214 |
tctaccatatctcacagtcatatt |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1026199 |
tctaccatatctcacagtcatatt |
1026222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 1025938 - 1026058
Alignment:
| Q |
1 |
agtataatgtataaaataccttagactaaaaatacttacaaatatatttacatttatccatctctaatggtactagtggtattagtgatgtttaaatctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
1025938 |
agtataatgtataaaataccttagactaaaaatacttataaatatatttacatttatccatctctaatggtactaatggtattagtgatgtttgaatctg |
1026037 |
T |
|
| Q |
101 |
gaacctctggacttaagattt |
121 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
1026038 |
gaacctttggacttaagattt |
1026058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University