View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13635_high_12 (Length: 226)
Name: NF13635_high_12
Description: NF13635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13635_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 78 - 211
Target Start/End: Original strand, 55073665 - 55073798
Alignment:
| Q |
78 |
ttttttgtatcccctacctgacctgctggcttgtggctacaaccttcttatgtgcaaaaaataatccatgcatgtcccactttcttagtatcatttattt |
177 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55073665 |
ttttttgtatcccctacctggcctgctggcttgtggctacaaccttcttatgtgcaaaaaataatccatgcatgtcccactttcttagtatcatttattt |
55073764 |
T |
|
| Q |
178 |
tatgtctgcttcgtgtagaactcaccatgatatt |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
55073765 |
tatgtctgcatcgtgtagaactcaccatgatatt |
55073798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 55073456 - 55073511
Alignment:
| Q |
24 |
aattattgaagcaaattaataactaccacaaca---ctcatataaacatacttagt |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
55073456 |
aattattgaagcaaattaataactaccacaacaaccctcatataaacatacttagt |
55073511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University