View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13636_low_13 (Length: 309)
Name: NF13636_low_13
Description: NF13636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13636_low_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 41697886 - 41697578
Alignment:
| Q |
1 |
agcgtttgtattcatattcatattttgttctcgaattcaaataaaattgctttataagtattctttccttttttggtctttatgttatgcagctacttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697886 |
agcgtttgtattcatattcatattttgttctcgaattcaaataaaattgctttataagtattctttccttttttggtctttatgttatgcagctacttaa |
41697787 |
T |
 |
| Q |
101 |
ttaaaggaagattgccaaatgggctattctttgttgcttatacatatgctggggagcttccaagctctgcatttgcatttaatagcaatggattggtaaa |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697786 |
ttaaaggaatattgccaaatgggctattctttgttgcttatacatatgctggggagcttccaagctctgcatttgcatttaatagcaatggattggtaaa |
41697687 |
T |
 |
| Q |
201 |
aattccctattatttcaaatgatctcttaatattaaagtaagtattaagaacaaaattttctttatgatcattaggcattcactctaaattcagtaccac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697686 |
aattccctattatttcaaatgatctcttaatattaaagtaagtattaagaacaaaatttgctttatgatcattaggcattcactctaaattcagtaccac |
41697587 |
T |
 |
| Q |
301 |
cagctgaag |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
41697586 |
cagctgaag |
41697578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University