View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13636_low_15 (Length: 298)
Name: NF13636_low_15
Description: NF13636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13636_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 31465332 - 31465474
Alignment:
| Q |
18 |
agagcccggtaagcttttgcaccaatgccatgaaatctttaggctgagtatgaataacacgtggagaatgtgtgtagattataaccgggctacgatgttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465332 |
agagcccggtaagcttttgcaccaatgccatgaaatctttaggctgagtatgtataacacgtggagaatgtgtgtagattataaccgggctacgatgttg |
31465431 |
T |
 |
| Q |
118 |
ttggggtggtttatttgatgccaccatggtattcatcattgca |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465432 |
ttggggtggtttatttgatgccaccatggtattcatcattgca |
31465474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 225 - 289
Target Start/End: Original strand, 31465539 - 31465603
Alignment:
| Q |
225 |
aatgagaatctttattgattttcaaatgtggtggtaacaatccattaacgttggtgttagatttt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465539 |
aatgagaatctttattgattttcaaatgtggtggtaacaatccattaacgttggtgttagatttt |
31465603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University