View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13636_low_17 (Length: 255)
Name: NF13636_low_17
Description: NF13636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13636_low_17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 134 - 255
Target Start/End: Complemental strand, 55322 - 55201
Alignment:
| Q |
134 |
caatagttctataacatttgtgtttactactaccacaatttctattaaatataattgatgatgcattccctacccctcttcttaaatcccatctccccat |
233 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55322 |
caatagttctataacatttgtgtttgctactaccacaatttctattaaatataattgatgatgcattccctacccctcttcttaaatcccatctccccat |
55223 |
T |
 |
| Q |
234 |
tatctccatttcgctactgtgc |
255 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
55222 |
tatctccatttcgctactgtgc |
55201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 170 - 255
Target Start/End: Complemental strand, 33754761 - 33754676
Alignment:
| Q |
170 |
aatttctattaaatataattgatgatgcattccctacccctcttcttaaatcccatctccccattatctccatttcgctactgtgc |
255 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
33754761 |
aatttatattaaacgtaactgatgatgcattccctacccctcttcttaaatcccatctccccattatatccatttcactactgtgc |
33754676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University