View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13636_low_8 (Length: 333)
Name: NF13636_low_8
Description: NF13636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13636_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 35 - 174
Target Start/End: Original strand, 8637783 - 8637922
Alignment:
| Q |
35 |
gatgcatgcttttattatgcatgtcttggtttagtgttcctttcatctctaatacttcgaaaatcaaatatgattgcttccctattaaagtttttgttca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8637783 |
gatgcatgcttttattatgcatgtcttggtttagtgttcctttcatctctaatacttcgaaaatcaaatatgattgcttccctattaaagtttttgttca |
8637882 |
T |
|
| Q |
135 |
ctttgtttgcaacttgaagaggaggaggatttgattcttg |
174 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
8637883 |
ctttgtttgcaacttaaagaagaggaggatttgattcttg |
8637922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 35 - 191
Target Start/End: Original strand, 6756080 - 6756243
Alignment:
| Q |
35 |
gatgcatgcttttattatgcatgtcttggtttagtgttcctttcatctc----taatacttcgaaaatcaaatatgattgcttccctattaaagttt-tt |
129 |
Q |
| |
|
|||||||| |||||| ||||| |||||||| |||||| ||||||||| |||| ||| |||||| |||| ||||||||||| ||||||||||| || |
|
|
| T |
6756080 |
gatgcatgtttttatagtgcataccttggtttggtgttcttttcatctcatattaattctttgaaaataaaatctgattgcttccttattaaagtttgtt |
6756179 |
T |
|
| Q |
130 |
gt--tcactttgtttgcaacttgaagaggaggaggatttgattcttgtgtttatcccatatcct |
191 |
Q |
| |
|
|| ||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
6756180 |
gtattcactttgtttgcaacttgaagaagaggaggatttgattcatgtgttttgcccatatcct |
6756243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 236 - 331
Target Start/End: Original strand, 6756949 - 6757044
Alignment:
| Q |
236 |
tttaaatccgactctttttagcaaccttgcaaggttatgagttgcaacattaagaagtctcctaaatgatagacacaagcacttcctattttttcc |
331 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||||||||||||||||||||| |||| |||||||||| | ||| ||||||||||||||||| |
|
|
| T |
6756949 |
tttagatccgactctttttaacaacctagcaaggttatgagttgcaacattaaaaagtgtcctaaatgacaaacattgacacttcctattttttcc |
6757044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University