View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13637_low_1 (Length: 519)
Name: NF13637_low_1
Description: NF13637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13637_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 61 - 303
Target Start/End: Complemental strand, 39276651 - 39276402
Alignment:
| Q |
61 |
aggcatgcccgggagagagatacatggactagtgggagtgggatcactgccaaaaatgcagcaacattgtctggtgatttgatcacattccctccatagc |
160 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276651 |
aggcatgcccgggagagagttacatggactagtgggagtgggatcactgccaaaaatgctgcaacattgtctggtgatttgatcacattccctccatagc |
39276552 |
T |
 |
| Q |
161 |
aaattttttagctggcacctgattattat--------caaatgcatgttttcattgatttatttgttaagctattattgtgaagtatgcgcaagttcttt |
252 |
Q |
| |
|
|||| |||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276551 |
aaat-ttttagctggcacctgattattattgtttttgcttatgcatgttttcattgatttatctgttaagctattattgtgaagtatgcgcaagttcttt |
39276453 |
T |
 |
| Q |
253 |
gtgtattttaaataaatttgtttcaagagctctatgatcattctcctctca |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276452 |
gtgtattttaaataaatttgtttcaagagctctatgatcattctcctctca |
39276402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 183; E-Value: 9e-99
Query Start/End: Original strand, 296 - 515
Target Start/End: Complemental strand, 39276382 - 39276163
Alignment:
| Q |
296 |
tcctctcataggtctccaagagcatttgattttagcaaaataaagtcgaggtcatttgcacaattataccgagtgggattgccaacttttaatgtattat |
395 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39276382 |
tcctttcataggtctccaagagcatttgattttagcaaaataaagtagaggtcatttgcacaattataccgagtgggattgccaactttttatgtattat |
39276283 |
T |
 |
| Q |
396 |
tttcccttttcttagattatttttgttagcagctatcataacttcctctttttcactctgcatcannnnnnnatattatacatctaaactatttcctttt |
495 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39276282 |
tttcccttttcttagattatttttgttagcagctatcataacttcctttttttcactctgcatcatttttttatattatacatctaaactatttcctttt |
39276183 |
T |
 |
| Q |
496 |
gctccctaaacattgctgca |
515 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39276182 |
gctccctaaacattgctgca |
39276163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 99 - 165
Target Start/End: Complemental strand, 39268415 - 39268350
Alignment:
| Q |
99 |
tgggatcactgccaaaaatgcagcaacattgtctggtgatttgatcacattccctccatagcaaatt |
165 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||| || ||||||||| ||||||||||||| |
|
|
| T |
39268415 |
tgggatcactgccaaacgagcagcaacattgtctgatgactt-ctcacattccttccatagcaaatt |
39268350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University