View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13638_high_10 (Length: 258)

Name: NF13638_high_10
Description: NF13638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13638_high_10
NF13638_high_10
[»] chr5 (1 HSPs)
chr5 (12-244)||(14937020-14937252)


Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 12 - 244
Target Start/End: Original strand, 14937020 - 14937252
Alignment:
12 atgaacacagggagagaaattctgaccgtgacagggatcgagatcatgggttggagaaacacaagacttatgataacagcaggaggctcttggatgcaaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14937020 atgaacacagggagagaaattctgaccgtgacagggatcgagatcatgggttggagaaacacaagacttatgataacagcaggaggctcttggatgcaaa 14937119  T
112 acagttgattgatatgataccaaagaccaaggaggagttgttctcatatgagatagactgggcagcgtacgacaaggtacttggttttttaactgtggat 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14937120 acagttgattgatatgataccaaagaccaaggaggagttgttctcatatgagatagactgggcagcgtacgacaaggtacttggttttttaactgtggat 14937219  T
212 tttgaatttagtaatcattttgtcttgatagtg 244  Q
    |||||||||||||||||||||||||||||||||    
14937220 tttgaatttagtaatcattttgtcttgatagtg 14937252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University