View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13638_low_10 (Length: 258)
Name: NF13638_low_10
Description: NF13638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13638_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 12 - 244
Target Start/End: Original strand, 14937020 - 14937252
Alignment:
| Q |
12 |
atgaacacagggagagaaattctgaccgtgacagggatcgagatcatgggttggagaaacacaagacttatgataacagcaggaggctcttggatgcaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14937020 |
atgaacacagggagagaaattctgaccgtgacagggatcgagatcatgggttggagaaacacaagacttatgataacagcaggaggctcttggatgcaaa |
14937119 |
T |
 |
| Q |
112 |
acagttgattgatatgataccaaagaccaaggaggagttgttctcatatgagatagactgggcagcgtacgacaaggtacttggttttttaactgtggat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14937120 |
acagttgattgatatgataccaaagaccaaggaggagttgttctcatatgagatagactgggcagcgtacgacaaggtacttggttttttaactgtggat |
14937219 |
T |
 |
| Q |
212 |
tttgaatttagtaatcattttgtcttgatagtg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14937220 |
tttgaatttagtaatcattttgtcttgatagtg |
14937252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University