View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13638_low_9 (Length: 259)
Name: NF13638_low_9
Description: NF13638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13638_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 44868639 - 44868429
Alignment:
| Q |
19 |
catgccattctttttgtcttgcttttctcagccaacgtcgtaaacactcttacgttataatattatatattggagattttggaggagttcagcgttgttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44868639 |
catgccattctttttgtcttgcttttctcagccaacgtcgtaaacactcttacgttataatattgtatattggagattttggaggagttcagcgttgttg |
44868540 |
T |
 |
| Q |
119 |
cattacagctcaaaaatagtaataaaacagacaagtttatgtttgtacataggttcattaacttttttgacgacttcaatcataacggtccggaaaaata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44868539 |
cattacagctcaaaaatagtaataaaacagacaagtttatgtttgta------ttcattaacttttttgacgacttcaatcataacggtccggaaaaata |
44868446 |
T |
 |
| Q |
219 |
taacaatatactttttc |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44868445 |
taacaatatactttttc |
44868429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University