View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13639_high_10 (Length: 215)

Name: NF13639_high_10
Description: NF13639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13639_high_10
NF13639_high_10
[»] chr1 (1 HSPs)
chr1 (62-200)||(46842623-46842761)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 62 - 200
Target Start/End: Complemental strand, 46842761 - 46842623
Alignment:
62 gtctcttttatgagtagagtggggttatttatttatgtttcattttcaatgtacctttaattgggcactagtttcagtcttccatcattaggcctgaagt 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46842761 gtctcttttatgagtagagtggggttatttatttatgtttcattttcaatgtacctttaattgggcactagtttcagtcttccatcattaggcctgaagt 46842662  T
162 tgcagagaaagaaagaagaaagtggtttgtgattggagt 200  Q
    |||||||||||||||||||||||||||||||||||||||    
46842661 tgcagagaaagaaagaagaaagtggtttgtgattggagt 46842623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University