View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13639_high_10 (Length: 215)
Name: NF13639_high_10
Description: NF13639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13639_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 62 - 200
Target Start/End: Complemental strand, 46842761 - 46842623
Alignment:
| Q |
62 |
gtctcttttatgagtagagtggggttatttatttatgtttcattttcaatgtacctttaattgggcactagtttcagtcttccatcattaggcctgaagt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46842761 |
gtctcttttatgagtagagtggggttatttatttatgtttcattttcaatgtacctttaattgggcactagtttcagtcttccatcattaggcctgaagt |
46842662 |
T |
 |
| Q |
162 |
tgcagagaaagaaagaagaaagtggtttgtgattggagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46842661 |
tgcagagaaagaaagaagaaagtggtttgtgattggagt |
46842623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University