View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13639_low_5 (Length: 395)
Name: NF13639_low_5
Description: NF13639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13639_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 5e-78; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 20 - 171
Target Start/End: Complemental strand, 31262084 - 31261933
Alignment:
| Q |
20 |
atggccataacgaaggatttcggaacgaagattattgtctaatgggtctaataaaccttcccaattggtcataccttggtattctttccatcttttgtta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31262084 |
atggccataacgaaggatttcggaacgaagattattgtctaatgggtctaataaaccttcccaattggtcataccttggtattctttccatcttttgtta |
31261985 |
T |
 |
| Q |
120 |
actttcgtagttggaaatggtaatggtgaaaatgttgattttgatgatgaaa |
171 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31261984 |
acttttgtagttggaaatggtaatggtgaaaatgttgattttgatgatgaaa |
31261933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 242 - 380
Target Start/End: Complemental strand, 31261862 - 31261724
Alignment:
| Q |
242 |
aagtgttatgcattgtggtttgatagtgaaggttgtggttttggggaaagaaatgtgggatgtagtgtggtttaaggatgtcattgtgattggtgagtga |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31261862 |
aagtgttatgcattgtggtttgatagtgaaggttgtggttttggggaaagaaatgtgggatgtagtgtggtttaaggatgtcattgtgattggtgagtga |
31261763 |
T |
 |
| Q |
342 |
gaaagagtgttgagaatggaaatgaatgagggaagtttg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31261762 |
gaaagagtgttgagaatggaaatgaatgagggaagtttg |
31261724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University