View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13639_low_7 (Length: 242)
Name: NF13639_low_7
Description: NF13639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13639_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 22 - 111
Target Start/End: Complemental strand, 50981811 - 50981722
Alignment:
| Q |
22 |
tcgcatgatcaattagttaatttataaggaaaatcatctcgcgttttcacaaattgtatgcacccatctcctttaatttcacttattttc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50981811 |
tcgcatgatcaattagttaatttataaggaaaatcatctcgcgttttcacaaattgtatgcacccatctcctttaatttcacttattttc |
50981722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 22 - 111
Target Start/End: Complemental strand, 51084945 - 51084856
Alignment:
| Q |
22 |
tcgcatgatcaattagttaatttataaggaaaatcatctcgcgttttcacaaattgtatgcacccatctcctttaatttcacttattttc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51084945 |
tcgcatgatcaattagttaatttataaggaaaatcatctcgcgttttcacaaattgtatgcacccatctcctttaatttcacttattttc |
51084856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 177 - 230
Target Start/End: Complemental strand, 50981655 - 50981602
Alignment:
| Q |
177 |
cccatctccttgatatatattggcacatctcttttcctttctggctttggccta |
230 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50981655 |
cccatctcctttatatatattggcacatctcttttcctttctggctttggccta |
50981602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 177 - 230
Target Start/End: Complemental strand, 51084789 - 51084736
Alignment:
| Q |
177 |
cccatctccttgatatatattggcacatctcttttcctttctggctttggccta |
230 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51084789 |
cccatctcctttatatatattggcacatctcttttcctttctggctttggccta |
51084736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University