View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13639_low_9 (Length: 234)
Name: NF13639_low_9
Description: NF13639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13639_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 62 - 215
Target Start/End: Original strand, 34883324 - 34883476
Alignment:
| Q |
62 |
ctactgttaccttgttttactacctacaaaatctagtctagtctatctaggaacatagtaatacttgtcaccgttggattttccttagacaaggatcatt |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34883324 |
ctactgttaccttgttttgctacctacaaaatctagtctagtctatctaggaacatagtaatact-gtcaccgttggattttccttagacaaggatcatt |
34883422 |
T |
 |
| Q |
162 |
catgactgagtttgtgatttacatgcatattacgtggcttcttatcctctttcc |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34883423 |
catgagtgagtttgtgatttacatgcatattacgtggcttcttatcctctttcc |
34883476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University